Gene: SYNPCC7942_RS09545


Descriptive name:

Model:

iJB785

Position:

Left: 1954814 – Right: 1955224

Strand:

Minus

Chromosome:

NC_007604.1

DNA Sequence

ATGAAACAACTTGCACAGCGACTGTTCTCCTTGGCGCTTGTGCTGGCGCTTGTGCTGGGTATTTCCGTGCAGTCTGCACAAGCACTGTCTCTTCAATCGCCCCTGCTAGCGGTCGCCGAAGCAGAGATTCGTAACGAAGCTGATGCTCAGCGGATCGAAGCTGGCGGCAAACTCGACCTCAACAACATTGGGGTTCGGGCATTCCAACAGTTTCCGGGAATGTACCCCTACCTCGCCAGCAAAATTGTTCTGGGTGGCCCTTACGACTCCGTGGATGATGTGCTGAAGCTCGATCTCAGCGATCGCCAACGGGAAGTCTTCGAGCAGTACAAAGAGAACTTCACCGTTACTCCTCCCCGCGACGCCCTCAACGAAGGGGATGACCGGATCAACAACGGCATCTATCGCTAA

Associated reactions:

BiGG ID
Name
Gene reaction rule
PSIIum
Photosystem II
(SYNPCC7942_RS01140 and SYNPCC7942_RS01145 and SYNPCC7942_RS01500 and SYNPCC7942_RS01750 and SYNPCC7942_RS02165 and SYNPCC7942_RS13675 and SYNPCC7942_RS03355 and SYNPCC7942_RS03360 and SYNPCC7942_RS03570 and SYNPCC7942_RS03575 and SYNPCC7942_RS03585 and SYNPCC7942_RS04600 and SYNPCC7942_RS05330 and SYNPCC7942_RS13745 and SYNPCC7942_RS06020 and SYNPCC7942_RS06025 and SYNPCC7942_RS06030 and SYNPCC7942_RS08350 and SYNPCC7942_RS08550 and SYNPCC7942_RS08555 and SYNPCC7942_RS13795 and SYNPCC7942_RS09545 and SYNPCC7942_RS09955 and SYNPCC7942_RS10225 and SYNPCC7942_RS11400 and SYNPCC7942_RS12590 and Synpcc7942_2010) or (SYNPCC7942_RS01140 and SYNPCC7942_RS01145 and SYNPCC7942_RS01500 and SYNPCC7942_RS01750 and SYNPCC7942_RS02165 and SYNPCC7942_RS13675 and SYNPCC7942_RS03355 and SYNPCC7942_RS03360 and SYNPCC7942_RS03570 and SYNPCC7942_RS03575 and SYNPCC7942_RS03585 and SYNPCC7942_RS05330 and SYNPCC7942_RS13745 and SYNPCC7942_RS06020 and SYNPCC7942_RS06025 and SYNPCC7942_RS06030 and SYNPCC7942_RS07110 and SYNPCC7942_RS08350 and SYNPCC7942_RS08550 and SYNPCC7942_RS08555 and SYNPCC7942_RS13795 and SYNPCC7942_RS09545 and SYNPCC7942_RS09955 and SYNPCC7942_RS10225 and SYNPCC7942_RS11400 and SYNPCC7942_RS12590 and Synpcc7942_2010)
PSIICSum
Photosystem II charge separation
(SYNPCC7942_RS01140 and SYNPCC7942_RS01145 and SYNPCC7942_RS01500 and SYNPCC7942_RS01750 and SYNPCC7942_RS02165 and SYNPCC7942_RS13675 and SYNPCC7942_RS03355 and SYNPCC7942_RS03360 and SYNPCC7942_RS03570 and SYNPCC7942_RS03575 and SYNPCC7942_RS03585 and SYNPCC7942_RS04600 and SYNPCC7942_RS05330 and SYNPCC7942_RS13745 and SYNPCC7942_RS06020 and SYNPCC7942_RS06025 and SYNPCC7942_RS06030 and SYNPCC7942_RS08350 and SYNPCC7942_RS08550 and SYNPCC7942_RS08555 and SYNPCC7942_RS13795 and SYNPCC7942_RS09545 and SYNPCC7942_RS09955 and SYNPCC7942_RS10225 and SYNPCC7942_RS11400 and SYNPCC7942_RS12590 and Synpcc7942_2010) or (SYNPCC7942_RS01140 and SYNPCC7942_RS01145 and SYNPCC7942_RS01500 and SYNPCC7942_RS01750 and SYNPCC7942_RS02165 and SYNPCC7942_RS13675 and SYNPCC7942_RS03355 and SYNPCC7942_RS03360 and SYNPCC7942_RS03570 and SYNPCC7942_RS03575 and SYNPCC7942_RS03585 and SYNPCC7942_RS05330 and SYNPCC7942_RS13745 and SYNPCC7942_RS06020 and SYNPCC7942_RS06025 and SYNPCC7942_RS06030 and SYNPCC7942_RS07110 and SYNPCC7942_RS08350 and SYNPCC7942_RS08550 and SYNPCC7942_RS08555 and SYNPCC7942_RS13795 and SYNPCC7942_RS09545 and SYNPCC7942_RS09955 and SYNPCC7942_RS10225 and SYNPCC7942_RS11400 and SYNPCC7942_RS12590 and Synpcc7942_2010)

Report an error on this page ?

External database links

Old identifiers

    Synpcc7942_1882

Latest BiGG Models publication:

King ZA, Lu JS, Dräger A, Miller PC, Federowicz S, Lerman JA, Ebrahim A, Palsson BO, and Lewis NE. BiGG Models: A platform for integrating, standardizing, and sharing genome-scale models (2016) Nucleic Acids Research 44(D1):D515-D522. doi:10.1093/nar/gkv1049


Copyright © 2019 The Regents of the University of California.