BiGG Models

Gene: SYNPCC7942_RS06880

Descriptive name:

Model:

Position:

Left: 1379614 – Right: 1379925

Strand:

Plus

Chromosome:

DNA Sequence

ATGACTGTACCTCTCGAGTACTTTTTGGTCTTGGCTGCCGCCCTGTTCTGTATTGGTGTCTATGGGTTGGTGACCAGCCGCAACGCCGTTCGCGTCTTGATGTCGATCGAATTGATGCTGAATGCCGTCAACCTCAACCTGATGGCCTTCTCCAACTATCTGGATGGCACATTGATTCGCGGCCAAGTCTTTACGGTTTTTGTGATTACGGTAGCAGCGGCAGAAGCGGCGGTTGGTCTCGCGATCTTGCTAGCGATTTACCGCAACCGCAACACGGTGGATATGGAACAGTTCAATCTTTTGAAATGGTAG

Associated reactions:

BiGG ID

Name

Gene reaction rule

NAD(P)H dehydrogenase (plastoquinone-8 & 4 protons)( Thylakoid)

SYNPCC7942_RS06865 and SYNPCC7942_RS07240 and SYNPCC7942_RS06045 and SYNPCC7942_RS06880 and SYNPCC7942_RS06875 and SYNPCC7942_RS08870 and SYNPCC7942_RS06870 and SYNPCC7942_RS06055 and SYNPCC7942_RS06050 and Synpcc7942_0413 and SYNPCC7942_RS11345 and SYNPCC7942_RS10050 and SYNPCC7942_RS12620 and SYNPCC7942_RS13830 and SYNPCC7942_RS09675 and SYNPCC7942_RS05670 and Synpcc7942_0668 and Synpcc7942_0491 and SYNPCC7942_RS07360 and SYNPCC7942_RS10025

NAD(P)H dehydrogenase, carbon dioxide coupled (plastoquinone-8 & 4 protons)( Thylakoid)

SYNPCC7942_RS06865 and SYNPCC7942_RS07240 and SYNPCC7942_RS06045 and SYNPCC7942_RS06880 and SYNPCC7942_RS06875 and SYNPCC7942_RS08870 and SYNPCC7942_RS06870 and SYNPCC7942_RS06055 and SYNPCC7942_RS06050 and Synpcc7942_0413 and SYNPCC7942_RS11345 and SYNPCC7942_RS10050 and SYNPCC7942_RS12620 and SYNPCC7942_RS13830 and SYNPCC7942_RS09675 and SYNPCC7942_RS05670 and SYNPCC7942_RS10605 and SYNPCC7942_RS10600 and SYNPCC7942_RS10610 and SYNPCC7942_RS10615

NAD(P)H dehydrogenase (plastoquinone-8 & 4 protons)( Thylakoid)

SYNPCC7942_RS06865 and SYNPCC7942_RS07240 and SYNPCC7942_RS06045 and SYNPCC7942_RS06880 and SYNPCC7942_RS06875 and SYNPCC7942_RS08870 and SYNPCC7942_RS06870 and SYNPCC7942_RS06055 and SYNPCC7942_RS06050 and Synpcc7942_0413 and SYNPCC7942_RS11345 and SYNPCC7942_RS10050 and SYNPCC7942_RS12620 and SYNPCC7942_RS13830 and SYNPCC7942_RS09675 and SYNPCC7942_RS05670 and SYNPCC7942_RS10025 and Synpcc7942_0668 and Synpcc7942_0491 and SYNPCC7942_RS10020

NAD(P)H dehydrogenase, carbon dioxide coupled (plastoquinone-8 & 4 protons)( Thylakoid)

SYNPCC7942_RS06865 and SYNPCC7942_RS07240 and SYNPCC7942_RS06045 and SYNPCC7942_RS06880 and SYNPCC7942_RS06875 and SYNPCC7942_RS08870 and SYNPCC7942_RS06870 and SYNPCC7942_RS06055 and SYNPCC7942_RS06050 and Synpcc7942_0413 and SYNPCC7942_RS11345 and SYNPCC7942_RS10050 and SYNPCC7942_RS12620 and SYNPCC7942_RS13830 and SYNPCC7942_RS09675 and SYNPCC7942_RS05670 and SYNPCC7942_RS03125 and SYNPCC7942_RS01575 and SYNPCC7942_RS01570

Report an error on this page ?

External database links

Old identifiers

Synpcc7942_1346